p eft-3 - cas9 -nls-pu6-sgrna vectors (Addgene inc)
Addgene inc is a verified supplier 
90
Structured Review
Addgene inc
p eft-3 - cas9 -nls-pu6-sgrna vectors
P Eft 3 Cas9 Nls Pu6 Sgrna Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p+eft-3+%3A%3Acas9/px330+u6+chimeric+bb+cbh+hspcas9/pmc11291935-230-14-32
Average 90 stars, based on 1 article reviews
P Eft 3 Cas9 Nls Pu6 Sgrna Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p+eft-3+%3A%3Acas9/px330+u6+chimeric+bb+cbh+hspcas9/pmc11291935-230-14-32
Average 90 stars, based on 1 article reviews
p eft-3 - cas9 -nls-pu6-sgrna vectors - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Mutagenesis:Article Title: A scaffold attachment factor PHM-2 regulates synaptic transmission through SLO-2 potassium channel in C. elegans Article Snippet: .. To generate phm-2 mutant, a guide RNA sequence 5’- GAGAAGCATGTTGCTGAGG was inserted into Sequencing:Article Title: A scaffold attachment factor PHM-2 regulates synaptic transmission through SLO-2 potassium channel in C. elegans Article Snippet: .. To generate phm-2 mutant, a guide RNA sequence 5’- GAGAAGCATGTTGCTGAGG was inserted into Article Title: Meisosomes, folded membrane microdomains between the apical extracellular matrix and epidermis Article Snippet: The transgene frSi26 is a single-copy insertion on chromosome II (ttTi5605 location) of pNP165 ( dpy-7 p::VHA-5::GFP) by CRISPR using a self-excising cassette (SEC) ( ). pNP165 was obtained by insertion of the dpy-7 promoter, which leads to an epidermal specific expression, in front of VHA-5::GFP into the pNP154 vector. pNP154 was made from a vector containing the SEC cassette for single insertion on chromosome II at the position of ttTi5605 (pAP087, kindly provided by Ari Pani) ( ). .. Constructs were designed using the plasmid editor Ape ( ) and made using Gibson Assembly (NEB Inc, MA) and confirmed by sequencing. pNP165 was injected in N2 at 20 ng/μl together with Article Title: Molecular basis of junctional current rectification at an electrical synapse Article Snippet: .. Specifically, a 19-bp guiding sequence identical to the target sequence in the first exon of unc-7b was cloned into a Injection:Article Title: Dose-dependent functions of SWI/SNF BAF in permitting and inhibiting cell proliferation in vivo Article Snippet: .. The injection mix contained the following: U6::gRNA target construct (100 ng/μl), pDD268 eGFP SEC vector (20 ng/μl) with 150-bp swsn-1 left homology arm and swsn-1 600-bp right homology arm, Article Title: C. elegans orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity Article Snippet: Cbr-unc-119 was derived from pCFJ150 vector (Addgene plasmid #19329). let-858 Terminator, p hsp16-41 ::CRE::tbb-2 3′UTR, and AID::3xFLAG were derived from pJW1584 (Addgene plasmid #121055). pU6:sgRNA (F+E) (pNLZ22) targeting odr-1 with guide sequence 5′- ggcgtcataggcggtaacgg was derived from pDD162 (Addgene plasmid #46149). .. To generate JZ2147: odr-1(py7) ( odr-1 ::mEGFP::AID::3xFLAG), Article Title: Meisosomes, folded membrane microdomains between the apical extracellular matrix and epidermis Article Snippet: The transgene frSi26 is a single-copy insertion on chromosome II (ttTi5605 location) of pNP165 ( dpy-7 p::VHA-5::GFP) by CRISPR using a self-excising cassette (SEC) ( ). pNP165 was obtained by insertion of the dpy-7 promoter, which leads to an epidermal specific expression, in front of VHA-5::GFP into the pNP154 vector. pNP154 was made from a vector containing the SEC cassette for single insertion on chromosome II at the position of ttTi5605 (pAP087, kindly provided by Ari Pani) ( ). .. Constructs were designed using the plasmid editor Ape ( ) and made using Gibson Assembly (NEB Inc, MA) and confirmed by sequencing. pNP165 was injected in N2 at 20 ng/μl together with Construct:Article Title: Dose-dependent functions of SWI/SNF BAF in permitting and inhibiting cell proliferation in vivo Article Snippet: .. The injection mix contained the following: U6::gRNA target construct (100 ng/μl), pDD268 eGFP SEC vector (20 ng/μl) with 150-bp swsn-1 left homology arm and swsn-1 600-bp right homology arm, Article Title: Meisosomes, folded membrane microdomains between the apical extracellular matrix and epidermis Article Snippet: The transgene frSi26 is a single-copy insertion on chromosome II (ttTi5605 location) of pNP165 ( dpy-7 p::VHA-5::GFP) by CRISPR using a self-excising cassette (SEC) ( ). pNP165 was obtained by insertion of the dpy-7 promoter, which leads to an epidermal specific expression, in front of VHA-5::GFP into the pNP154 vector. pNP154 was made from a vector containing the SEC cassette for single insertion on chromosome II at the position of ttTi5605 (pAP087, kindly provided by Ari Pani) ( ). .. Constructs were designed using the plasmid editor Ape ( ) and made using Gibson Assembly (NEB Inc, MA) and confirmed by sequencing. pNP165 was injected in N2 at 20 ng/μl together with Plasmid Preparation:Article Title: C. elegans orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity Article Snippet: Cbr-unc-119 was derived from pCFJ150 vector (Addgene plasmid #19329). let-858 Terminator, p hsp16-41 ::CRE::tbb-2 3′UTR, and AID::3xFLAG were derived from pJW1584 (Addgene plasmid #121055). pU6:sgRNA (F+E) (pNLZ22) targeting odr-1 with guide sequence 5′- ggcgtcataggcggtaacgg was derived from pDD162 (Addgene plasmid #46149). .. To generate JZ2147: odr-1(py7) ( odr-1 ::mEGFP::AID::3xFLAG), Article Title: An assessment of genome-editing efficiency of a newly developed Cas9 in C. elegans Article Snippet: .. Plasmids construction: Article Title: In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9 Article Snippet: .. pDD162 , Article Title: Meisosomes, folded membrane microdomains between the apical extracellular matrix and epidermis Article Snippet: The transgene frSi26 is a single-copy insertion on chromosome II (ttTi5605 location) of pNP165 ( dpy-7 p::VHA-5::GFP) by CRISPR using a self-excising cassette (SEC) ( ). pNP165 was obtained by insertion of the dpy-7 promoter, which leads to an epidermal specific expression, in front of VHA-5::GFP into the pNP154 vector. pNP154 was made from a vector containing the SEC cassette for single insertion on chromosome II at the position of ttTi5605 (pAP087, kindly provided by Ari Pani) ( ). .. Constructs were designed using the plasmid editor Ape ( ) and made using Gibson Assembly (NEB Inc, MA) and confirmed by sequencing. pNP165 was injected in N2 at 20 ng/μl together with Article Title: Molecular basis of junctional current rectification at an electrical synapse Article Snippet: .. Specifically, a 19-bp guiding sequence identical to the target sequence in the first exon of unc-7b was cloned into a Knock-Out:Article Title: A scaffold attachment factor PHM-2 regulates synaptic transmission through SLO-2 potassium channel in C. elegans Article Snippet: .. To generate phm-2 knockout, a guide RNA sequence 5’- GAGAAGCATGTTGCTGAGG was inserted into Clone Assay:Article Title: Molecular basis of junctional current rectification at an electrical synapse Article Snippet: .. Specifically, a 19-bp guiding sequence identical to the target sequence in the first exon of unc-7b was cloned into a |
